| Primary Identifier | MGI:6199642 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tubb2b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATTATCACTAGCACAAAGGG, GGGCTGCTCATTGAGATTGG, TTGAAATAGCCTTATCTGAG and ATCAGAAAGTTGAAACTGGG, which resulted in a 595 bp deletion beginning at Chromosome 13 position 34,128,808 bp and ending after 34,129,402 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001073370 and ENSMUSE00001093042(exons 2 and 3) and 375 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 27 amino acids later. |
