| Primary Identifier | MGI:6200400 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mxra8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACTGCAGGAGGCCCCAAG and GGTGGTATACAATGGTGGGA, which resulted in a 3613 bp deletion beginning at Chromosome 4 position 155,840,716 bp and ending after 155,844,328 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503248 through ENSMUSE00000228201 (exons 2 through 10) and 1575 bp of flanking intronic sequence including the splice acceptors and donors. |
