|  Help  |  About  |  Contact Us

Allele : Mxra8<em1(IMPC)J> matrix-remodelling associated 8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6200400 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Mxra8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGACTGCAGGAGGCCCCAAG and GGTGGTATACAATGGTGGGA, which resulted in a 3613 bp deletion beginning at Chromosome 4 position 155,840,716 bp and ending after 155,844,328 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503248 through ENSMUSE00000228201 (exons 2 through 10) and 1575 bp of flanking intronic sequence including the splice acceptors and donors.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele