| Primary Identifier | MGI:6200410 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Kctd11 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCGCTTTGTGCGCCACTGA and CCATGCTGGGGGCCATGTTT, which resulted in a 697 bp deletion beginning at Chromosome 11 position 69,879,502 bp and ending after 69,880,198 bp (GRCm38/mm10). This mutation deletes 697 bp of ENSMUSE00000354980 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 103 amino acids later by read-through into the 3-prime UTR. |
