|  Help  |  About  |  Contact Us

Allele : Kctd11<em1(IMPC)J> potassium channel tetramerisation domain containing 11; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6200410 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Kctd11
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCGCTTTGTGCGCCACTGA and CCATGCTGGGGGCCATGTTT, which resulted in a 697 bp deletion beginning at Chromosome 11 position 69,879,502 bp and ending after 69,880,198 bp (GRCm38/mm10). This mutation deletes 697 bp of ENSMUSE00000354980 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and truncation 103 amino acids later by read-through into the 3-prime UTR.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele