| Primary Identifier | MGI:6200431 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lrfn1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGCCCGGAGGAGAAGGGGCC and CAGATGACTCCCTAGTCTAC, which resulted in a 1398 bp deletion beginning at Chromosome 7 position 28,458,664 bp and ending after 28,460,061 bp (GRCm38/mm10). This mutation deletes 1398 bp of ENSMUSE00000365917 (exon 1) and is predicted to cause a change of amino acid sequence and early truncation after residue 4. |
