| Primary Identifier | MGI:6194251 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp512 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ACACAATTCCTCTTACACCC, GAAGATCTAATGGTTTCTGA, TTGTGTAAAACTATGAAGAC and GTTTATCAGTAGTGAGGTGA, which resulted in a 688 bp deletion beginning at Chromosome 5 position 31,465,168 bp and ending after 31,465,855 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000513436 (exon 3) and 500 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 3 amino acids later. |
