| Primary Identifier | MGI:6194257 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | 1600014C10Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCAGCCTCATTCCCCAACAA, GCACTGCCTACACAGGACTG, TCTTAGTTGGCACAGTTCTG and GACCGGGGCTCTCTGTGTGG, which resulted in a 3,339 bp deletion beginning at Chromosome 7 position 38,194,467 bp and ending after 38,197,805 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000635238 and ENSMUSE00000446563 (exons 3,4) and 480 bp of flanking intronic and 3 downstream sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 43 amino acids later. |
