| Primary Identifier | MGI:6200319 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tesk1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGTGTGCCCGACAGGTTGGG, ACGGGTGGAACGATTAAAGA, CCAGCAAGCTGTCCAGCAAG and GTAGATACGTTAGGATGTCG, which resulted in a 899 bp deletion beginning at Chromosome 4 position 43,443,924 bp and ending after 43,444,822 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000179378, ENSMUSE00000384697 (exons 3 and 4) and 703 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 154 amino acids later. In addition, there is a 5 bp deletion (CCAAC) 175 bp before the deletion and a single bp [C] insertion at the deletion site. |