|  Help  |  About  |  Contact Us

Allele : Tesk1<em1(IMPC)J> testis specific protein kinase 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6200319 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tesk1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGTGTGCCCGACAGGTTGGG, ACGGGTGGAACGATTAAAGA, CCAGCAAGCTGTCCAGCAAG and GTAGATACGTTAGGATGTCG, which resulted in a 899 bp deletion beginning at Chromosome 4 position 43,443,924 bp and ending after 43,444,822 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000179378, ENSMUSE00000384697 (exons 3 and 4) and 703 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 154 amino acids later. In addition, there is a 5 bp deletion (CCAAC) 175 bp before the deletion and a single bp [C] insertion at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories