| Primary Identifier | MGI:6200336 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fchsd2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TCCTACATAACAGCTTCCAG, AAGGCTAGATGGTCAGAAAT, CTAGTAAGATATATGGAGGG and GGAATTGCAATTTCTGTCTT, which resulted in a 288 bp deletion beginning at Chromosome 7 position 101,138,935 bp and ending after 101,139,222 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001209356 (exon 3) and 242 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 9 amino acids later. |