| Primary Identifier | MGI:6200361 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mrgprg |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project Mrgprg-115062J-8267M was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATAGCCCCCCAAGACCTGAC and TGTTCTCCATATTCAACATC, which resulted in an 819 bp deletion beginning at Chromosome 7 position 143,764,544 bp and ending after 143,765,362 bp (GRCm38/mm10). This mutation deletes 819 bp of ENSMUSE00000378852 (exon 2) and is predicted to cause a deletion of 273 amino acids after residue 4 and before residue 277. This would effectively remove all but 16 amino acids of the coding sequence. |
