| Primary Identifier | MGI:6194214 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dusp23 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGCCAATGCCCGGGGAG and GGAAGCACCCAGGAGAAGTT, which resulted in a 263 bp deletion beginning at Chromosome 1 position 172,632,616 bp and ending after 172,632,878 bp (GRCm38/mm10). This mutation creates an internal deletion of 263 bp in ENSMUSE00000160363 (exon 1) resulting in a frame shift that is predicted to cause a change of amino acid sequence after residue 2 and early truncation 33 amino acids later. |
