|  Help  |  About  |  Contact Us

Allele : Trex1<em1Aiwsk> three prime repair exonuclease 1; endonuclease-mediated mutation 1, Akiko Iwasaki

Primary Identifier  MGI:6201209 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Trex1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/Cas9 is used to remove the single coding exon of the gene. Two single guide RNAs (sgRNAs) were employed: CTGTTAATTAGCCTAACAGG in the region upstream of the coding exon, and TCAGGGTAATTCCCGAAGAG in the downstream region. The intervening sequence was excised.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories