|  Help  |  About  |  Contact Us

Allele : Arhgap4<em1(IMPC)J> Rho GTPase activating protein 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6201201 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Arhgap4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTTAGTCATGACCTTCAGCA, TGTCTGCCCGCCCTAAACCA, ATTTCAGATCTGAATCTTGG and TCAGAAGCCCCTGTGCACTT, which resulted in a 1177 bp deletion beginning at Chromosome X position 73,905,895 bp and ending after 73,907,071 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001242137, ENSMUSE00001255499, ENSMUSE00001218299 (exons 2-4) and 743 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 15 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories