| Primary Identifier | MGI:6201201 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Arhgap4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CTTAGTCATGACCTTCAGCA, TGTCTGCCCGCCCTAAACCA, ATTTCAGATCTGAATCTTGG and TCAGAAGCCCCTGTGCACTT, which resulted in a 1177 bp deletion beginning at Chromosome X position 73,905,895 bp and ending after 73,907,071 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001242137, ENSMUSE00001255499, ENSMUSE00001218299 (exons 2-4) and 743 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 15 amino acids later. |
