|  Help  |  About  |  Contact Us

Allele : Apobr<em1(IMPC)J> apolipoprotein B receptor; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6198556 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Apobr
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAGGACACAAACGCACTGA and GTTGCTGTGAACATCCCCTG, which resulted in a 2414 bp deletion beginning at Chromosome 7 position 126,585,381 bp and ending after 126,587,794 bp (GRCm38/mm10). This mutation deletes 2414 bp of (ENSMUSE00000349153) (exon 2) and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 4 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories