| Primary Identifier | MGI:6198556 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Apobr |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAGGACACAAACGCACTGA and GTTGCTGTGAACATCCCCTG, which resulted in a 2414 bp deletion beginning at Chromosome 7 position 126,585,381 bp and ending after 126,587,794 bp (GRCm38/mm10). This mutation deletes 2414 bp of (ENSMUSE00000349153) (exon 2) and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 4 amino acids later. |
