|  Help  |  About  |  Contact Us

Allele : Zfp787<em1(IMPC)J> zinc finger protein 787; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6198582 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp787
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAACTTGGACCAGAGATAGA and TGGTCTGCAGATCTAGAGAA, which resulted in a 2331 bp deletion beginning at Chromosome 7 position 6,131,115 bp and ending after 6,133,445 bp (GRCm38/mm10). This mutation deletes (ENSMUSE00000600779) (exon 3) and 648 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 43 amino acids later due to run on after exon 2. There is a 3 bp (CCA) endogenous retention at the deletion site that will not alter the results of the deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories