|  Help  |  About  |  Contact Us

Allele : Klf16<em1(IMPC)J> Kruppel-like transcription factor 16; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6198606 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Klf16
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCATGCGGTCTATGGATA and CGCACCTCAAGTCACACCTG, which resulted in a 444 bp deletion beginning at Chromosome 10 position 80,576,763 bp and ending after 80,577,206 bp (GRCm38/mm10). This mutation deletes 444 bp from (ENSMUSE00000307925) (exon 1)including the Kozak sequence and ATG start and leaving the final 16 bp of exon 1 and splice donor.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories