| Primary Identifier | MGI:6198606 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Klf16 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCATGCGGTCTATGGATA and CGCACCTCAAGTCACACCTG, which resulted in a 444 bp deletion beginning at Chromosome 10 position 80,576,763 bp and ending after 80,577,206 bp (GRCm38/mm10). This mutation deletes 444 bp from (ENSMUSE00000307925) (exon 1)including the Kozak sequence and ATG start and leaving the final 16 bp of exon 1 and splice donor. |
