| Primary Identifier | MGI:6198633 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp438 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTGTCAGGTCCTTGCATACC and GGTGAATCAAACATCCGTTC, which resulted in a 1756 bp deletion beginning at Chromosome 18 position 5,213,148 bp and ending after 5,214,903 bp (GRCm38/mm10). This mutation deletes 1756 bp of (ENSMUSE00000343297) (exon 4) and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 21 amino acids later. |