| Primary Identifier | MGI:6196082 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmie |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences TGGCCCGTCAGCCCTCCACA, ACAGTCTGTCCTAGTCAGCG, TGACATGTCCTGGATTCAGT and AGGGACTTGGACTCGAAGGG, which resulted in a 608 bp deletion beginning at Chromosome 9 position 110,870,349 bp and ending after 110,870,956 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000388720 (exon 4) and 490 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 67 amino acids later. |
