| Primary Identifier | MGI:6201606 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cyp4f39 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGAGTGGGGAGCAACTCA and GATAGAAGTTCACCAAACTG, which resulted in a 437 bp deletion beginning at Chromosome 17 position 32,470,647 bp and ending after 32,471,083 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000511656 (exon 2) and 292 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 13 amino acids later. |
