| Primary Identifier | MGI:6208874 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Krt40 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences GTTTCCTCAAGGCCTGACTA, TCCATAACTGTAGCTCCGTG, AGTGAAAGAAAGGCGTGGCC and AAGTTCAGATTCTCTTGGTT, which resulted in a 2013 bp deletion beginning at Chromosome 11 position 99,538,431 bp and ending after 99,540,443 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000503157, ENSMUSE00001061939, ENSMUSE00000577306 (exons 4-6) and 1504 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 229 and early truncation 16 amino acids later. |
