|  Help  |  About  |  Contact Us

Allele : Cmya5<em1(IMPC)J> cardiomyopathy associated 5; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6209671 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cmya5
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CGAGGTTTCAGCACTCGACA and GTTATCAGATGAGGATGAGG, which resulted in a 9281 bp deletion beginning at Chromosome 13 position 93,089,133 bp and ending after 93,098,413 bp (GRCm38/mm10). This mutation deletes 9281 bp from ENSMUSE00000356892 (exon 2) and is predicted to cause a change of amino acid sequence after residue 55 and early truncation 3 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

6 Publication categories