|  Help  |  About  |  Contact Us

Allele : Cd4<em2Litt> CD4 antigen; endonuclease-mediated mutation 2, Dan R Littman

Primary Identifier  MGI:6220678 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Cd4
Strain of Origin  Not Specified Is Recombinase  false
Is Wild Type  false
description  Cas9 and guide RNAs were co-injected into embryos derived from Cd4tm3.2Litt mice on a C57BL/6J, 129, and FVB mixed genetic background.
molecularNote  Using (Rr94tm3.2Litt) embryos, CRISPR/cas9 technology was used with gRNAs (targeting AAGCCAGGCTACTTGTTTAC and AGCCAATTCCCAGCGTGCGT), resulting in the deletion of the "maturity" enhancer E4m, a novel cis regulatory element in intron 1 of the Cd4 gene (chr6:124861957-124862580 (GRCm39)).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cd4<E4mdelta>,
  • Cd4<E4mdelta>,
  • Rr95<em2Litt>,
  • Rr95<em2Litt>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories