| Primary Identifier | MGI:6220678 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Cd4 |
| Strain of Origin | Not Specified | Is Recombinase | false |
| Is Wild Type | false |
| description | Cas9 and guide RNAs were co-injected into embryos derived from Cd4tm3.2Litt mice on a C57BL/6J, 129, and FVB mixed genetic background. |
| molecularNote | Using (Rr94tm3.2Litt) embryos, CRISPR/cas9 technology was used with gRNAs (targeting AAGCCAGGCTACTTGTTTAC and AGCCAATTCCCAGCGTGCGT), resulting in the deletion of the "maturity" enhancer E4m, a novel cis regulatory element in intron 1 of the Cd4 gene (chr6:124861957-124862580 (GRCm39)). |