|  Help  |  About  |  Contact Us

Allele : C2cd3<em1(IMPC)Tcp> C2 calcium-dependent domain containing 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257547 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  C2cd3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1071 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACCCTGACAGTTACATT and ATGCAGTGTGATGAATACTG targeting the 5' side and CAGCATGAGAACCGTGGGAG targeting the 3' side of a critical exon. This resulted in a 1062-bp deletion Chr7:100389398 to 100390459 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

4 Publication categories