| Primary Identifier | MGI:6257571 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gnl1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1105 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTTCCCTGCTTGGTGCGGCT targeting the 5' side and CCTTCCCACCATCTGGCGAG targeting the 3' side leading to a 738-bp deletion from Chr17:35982400 to 35983137_insGG resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). |
