| Primary Identifier | MGI:6257482 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lrrc56 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1151 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of AAGTGATCCAGTGCTGTCAT targeting the 5' side and ACAAGCCAGAAGGTACACGT and TGTGGAGTCACCTGCTATAA targeting the 3' side of a critical exon. This resulted in a 997-bp del Chr7:141205029 to 141206025 (GRCm38). |
