| Primary Identifier | MGI:6257492 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nnt |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NTac |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA, 4 guide sequences CTTGTCAAAAACAGCAGTCTGGG, CCTTGTCAAAAACAGCAGTCTGG, GAGCATGGCCGAGATTACTCCGG, ATGCTTGGCCGGAGTAATCTCGG, and a non-contributing oligo, which resulted in a Exon Deletion. |
