| Primary Identifier | MGI:6257508 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Apoe |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6N |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Bayor College of Medicine by injecting CAS9 Protein and 4 guide sequences (equivalent to CCTAGTTGAGCCGGTACGCCGTG, GGGCCACCAGAGGGCCAGAGAGG, TATTAAGCAAGGGCCACCAGAGG, CCGTGCACCGACAGTCCCGTACT), which resulted in an Exon Deletion. |
