| Primary Identifier | MGI:6257511 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ablim3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1104 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs having spacer sequences of CAGGGGTGGATGCCTAAGCT and CATGAGTTGACGTGAGATGG targeting the 5' side and CGACACAGTTTGAAAACTAC and CTTATCTCATCATGCCCAGT targeting the 3' side of a critical exon resulting in a 578-bp del Chr18: 61856803 to 61857380 (GRCm38). |
