|  Help  |  About  |  Contact Us

Allele : Ablim3<em1(IMPC)Tcp> actin binding LIM protein family, member 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257511 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ablim3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1104 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with four single guide RNAs having spacer sequences of CAGGGGTGGATGCCTAAGCT and CATGAGTTGACGTGAGATGG targeting the 5' side and CGACACAGTTTGAAAACTAC and CTTATCTCATCATGCCCAGT targeting the 3' side of a critical exon resulting in a 578-bp del Chr18: 61856803 to 61857380 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele