| Primary Identifier | MGI:6257527 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hibch |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1207 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CCTTCATAAAACACTCGCAG and CCAAACATAAGAGACGATAA targeting the 5' side and ATGTTGGTGATACTAGGGGC and GAGTCTGCACACAGCGGGTT targeting the 3' side of a critical exon. This resulted in a 496-bp deletion Chr1:52862152 to 52862647 (GRCm38). |
