|  Help  |  About  |  Contact Us

Allele : Col6a3<em1(IMPC)Tcp> collagen, type VI, alpha 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257456 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Col6a3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1074 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATTGCTACCCGGGTCCCATC, ACGCCCTGGACTACGCGCTT, GCTGCACGTTATCCTCGATG. This resulted in a 193-bp del Chr1: 90811522 to 90811714 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

4 Publication categories