|  Help  |  About  |  Contact Us

Allele : Cdh23<em3(IMPC)H> cadherin related 23 (otocadherin); endonuclease-mediated mutation 3, Harwell

Primary Identifier  MGI:6257460 Allele Type  Endonuclease-mediated
Gene  Cdh23 Inheritance Mode  Not Specified
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting D10A RNA, 2 guide sequences CCTACAGTACTAACATCTACGAG, CCACGCAGGACAGGCATTTGTCT, and a donor oligo, which resulted in a point mutation allele.
  • mutations:
  • Single point mutation
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories