| Primary Identifier | MGI:6257460 | Allele Type | Endonuclease-mediated |
| Gene | Cdh23 | Inheritance Mode | Not Specified |
| Strain of Origin | C57BL/6NTac | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Medical Research Council Harwell by injecting D10A RNA, 2 guide sequences CCTACAGTACTAACATCTACGAG, CCACGCAGGACAGGCATTTGTCT, and a donor oligo, which resulted in a point mutation allele. |
