| Primary Identifier | MGI:6257629 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Unc80 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1158 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TTATAAGGCTTATTGCCATT, CACGGGACAACCACACAAAC and AGGAAGTTAAAGTTACCCGT targeting a critical region. This resulted in a 464 bp deletion from Chr1:66473206 to 66473669 (GRCm38). |
