|  Help  |  About  |  Contact Us

Allele : Pcdhb13<em1(IMPC)Tcp> protocadherin beta 13; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257657 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pcdhb13
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1123 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TTAGCCCCAAGTGCTTAGTC, TGCGATTGCGAGTGAGCACG, GTCCAATACTTGGACGACTA. This resulted in a 415-bp del Chr18: 37442713 to 37443127 which corresponds to c.143_557del and is predicted to cause p.T48Mfs*7 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

4 Publication categories