|  Help  |  About  |  Contact Us

Allele : Hps6<em1(IMPC)Tcp> HPS6, biogenesis of lysosomal organelles complex 2 subunit 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257719 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hps6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1137 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GCTCCGCGAGTTGTTGGCGG, AAAAGACGTCCAGCGGCGAG and GGGTCCACGAGGTGGTGTAG targeting a critical exon. This resulted in a 36-bp deletion Chr19:46003690 to 46003725 and 2,084-bp del Chr19:46003853 to 46005936 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

4 Publication categories