|  Help  |  About  |  Contact Us

Allele : Psma8<em1(IMPC)Tcp> proteasome subunit alpha 8; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257761 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Psma8
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1204 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATACAACTACGTTAGGGTGA and TGCACATCTTATCTCCTAGA targeting the 5' side and TTAGCCCTCACCTATGTTTA and AGGCCACAGCTCTATAAACT targeting the 3' side of a critical exon. This resulted in a 5-bp deletion at Chr18:14720902 to 14720906_CCCTA in the intron and a 382-bp del Chr18:14721054 to 14721435 which deleted exon ENSMUSE00000281907. This is predicted to result in p.(G36X) (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

4 Publication categories