| Primary Identifier | MGI:6257761 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Psma8 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1204 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATACAACTACGTTAGGGTGA and TGCACATCTTATCTCCTAGA targeting the 5' side and TTAGCCCTCACCTATGTTTA and AGGCCACAGCTCTATAAACT targeting the 3' side of a critical exon. This resulted in a 5-bp deletion at Chr18:14720902 to 14720906_CCCTA in the intron and a 382-bp del Chr18:14721054 to 14721435 which deleted exon ENSMUSE00000281907. This is predicted to result in p.(G36X) (GRCm38). |