| Primary Identifier | MGI:6257703 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Hk3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1106 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CAGAGTACTGGTTAGAATCT and CCACATCAATCCTGTAGGTC targeting the 5' side and AGGCCTCAGTGTAACCGGGC and CTCGGGGTTCTAGCACGCTG targeting the 3' side of a critical exon. This resulted in a 686-bp del Chr13: 55012899 to 55013584, 12-bp del Chr13: 55013738 to 55013749 (GRCm38). |
