| Primary Identifier | MGI:6257705 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tnk2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR1088 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGAACATGGAGTTCGTTCAT and AGAGAGTGGCATCGATCTAC targeting the 5' side and ACCGCAAGGTGCCCTTTGCC targeting the 3' side of a critical region. This resulted in a 320-bp deletion Chr16:32669908 to 32670227 (GRCm38). |