|  Help  |  About  |  Contact Us

Allele : Cpsf4l<em1(IMPC)J> cleavage and polyadenylation specific factor 4-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6220914 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cpsf4l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTGAACGGAGAGAACACA and GTGTTTTGCAGAAAGTACCG, which resulted in a 3917 bp deletion beginning at Chromosome 11 position 113,699,772 bp and ending after 113,703,688 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108704-ENSMUSE00001266028 (exons 4-6) and 3577 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 17 amino acids later. In addition, there is a 2 bp (TC) insertion at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories