| Primary Identifier | MGI:6220914 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cpsf4l |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTGAACGGAGAGAACACA and GTGTTTTGCAGAAAGTACCG, which resulted in a 3917 bp deletion beginning at Chromosome 11 position 113,699,772 bp and ending after 113,703,688 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108704-ENSMUSE00001266028 (exons 4-6) and 3577 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 51 and early truncation 17 amino acids later. In addition, there is a 2 bp (TC) insertion at the deletion site. |
