| Primary Identifier | MGI:6220917 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tas2r103 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACAAACATATAGAGAATTG and ATAAGTCTGGAGTTTATCAT, which resulted in an 861 bp bp deletion beginning at Chromosome 6 position 133,036,176 bp and ending after 133,037,036 bp (GRCm38/mm10). This mutation deletes 861 bp from ENSMUSE00000196281 (exon 1) and is predicted to cause a change of amino acid sequence after residue 22 back in frame for stop 3 amino acids later. |
