|  Help  |  About  |  Contact Us

Allele : Tas2r103<em1(IMPC)J> taste receptor, type 2, member 103; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6220917 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tas2r103
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TACAAACATATAGAGAATTG and ATAAGTCTGGAGTTTATCAT, which resulted in an 861 bp bp deletion beginning at Chromosome 6 position 133,036,176 bp and ending after 133,037,036 bp (GRCm38/mm10). This mutation deletes 861 bp from ENSMUSE00000196281 (exon 1) and is predicted to cause a change of amino acid sequence after residue 22 back in frame for stop 3 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele