|  Help  |  About  |  Contact Us

Allele : Akap8l<em1(IMPC)J> A kinase anchor protein 8-like; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6231175 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Akap8l
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTCTGCCTAGGAAAAACGG and TGGAGTCAAGAGACTCCAAA, which resulted in a 964 bp deletion beginning at Chromosome 17 position 32,335,377 bp and ending after 32,336,340 bp (GRCm38/mm10). This mutation deletes the last 56 bp of ENSMUSE00000137572 (exon 5), all of ENSMUSE00000137565, ENSMUSE00000137575, and ENSMUSE00000137582 (exons 6, 7, 8), and 679 bp of flanking intronic sequence including the splice acceptors and donors. This is predicted to cause a change of amino acid sequence after residue 254 and early truncation 11 amino acids later due to read through into the intron between exons 8 and 9.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories