| Primary Identifier | MGI:6269385 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Myh13 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGAATCAGGTTAACCAAG and ATTATAGTAGTCATGGTGAA, which resulted in a 738 bp deletion beginning at Chromosome 11 position 67,328,779 bp and ending after 67,329,516 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000578946 and ENSMUSE00001022684 (exons 2 and 3) and 437 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 7 amino acids later. |