|  Help  |  About  |  Contact Us

Allele : Nfyc<em1(IMPC)J> nuclear transcription factor-Y gamma; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6258566 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nfyc
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGATCAGTAGAAACAAGACT and AATTGTTTCATTCAGTGTTA, which resulted in a 292 bp deletion beginning at Chromosome 4 position 120,790,326 bp and ending after 120,790,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000412384 (exon 2) and 179 bp of flanking intronic sequence including the start and splice donor and is predicted to cause a null allele unless a downstream ATG is used. In addition, there is a 7 bp insertion [TATCAGT] at the deletion site.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories