| Primary Identifier | MGI:6258602 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Vps26c |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGTAAGAAGCTGCGTAAGT and GTACACATATTAGGGACAAA, which resulted in a 1215 bp deletion beginning at Chromosome 16 position 94,501,242 bp and ending after 94,502,456 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000131739, ENSMUSE00000131736 (exons 5,6) and 911 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 169 and early truncation 21 amino acids later. |